Prev. | 

RIKEN DNA Bank Human Resource - SKA2

Gene ID NCBI Gene 348235 |  KEGG hsa:348235
Gene Symbol SKA2
Protein Name spindle and kinetochore associated complex subunit 2
Synonyms FAM33A
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY094645 IRAL036K05 pDNR-LIB BC017873 NM_182620 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR179348 ARi48G04 pGCAP10 NM_182620.3  
AACTATTCAACATGGAGGCGGAGGTCGATAAGCTGGAACTGATGTTCCAGAAAGCTGAGT
HKR260016 ARiS150A16 pGCAP10 NM_182620.3  
HKR325602 RBb14A02 pKA1U5 NM_182620.3  
GATTCAACATGGAGGCGGAGGTCGATAAGCTGGAACTGATGTTCCAGAAAGCTGAGTCTG
HKR326450 RBb16C02 pKA1U5 NM_182620.3  
GATTCAACATGGAGGCGGAGGTCGATAAGCTGGAACTGATGTTCCAGAAAGCTGAGTCTG
HKR405273 RBdS013D01 pGCAP10 NM_182620.3  
GGTCAACTATTCAACATGGAGGCGGAGGTCGATAAGCTGGAACTGATGTTCCAGAAAGCT
HKR405557 RBdS013O21 pGCAP10 NM_182620.3  
GATTCAACATGGAGGCGGAGGTCGATAAGCTGGAACTGATGTTCCAGAAAGCTGAGTCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl