Prev. |  KEGG KO K14169 > 

RIKEN DNA Bank Human Resource - CTU2

Gene ID NCBI Gene 348180 |  KEGG hsa:348180
Gene Symbol CTU2
Protein Name cytosolic thiouridylase subunit 2
Synonyms C16orf84|NCS2|UPF0432
Ortholog resources KEGG ortholog (KEGG orthology K14169) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX035658 IRAK089C10 pCMV-SPORT6 BC044951 NM_001012762 Partial/var
HGX053665 IRAK134C17 pCMV-SPORT6 BC063512 NM_001012759 Full/var
HGY103745 IRAL059G01 pOTB7 BC080540 NM_001012759 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR379726 RBd49F06 pGCAP10 NM_001012759.1  
GACACAGTCTGCGACGGGACCCGGCGTGCCCATGTGTCAGGTGGGCGAGGACTACGGGGA
HKR380906 RBd52E10 pGCAP10 NM_001012759.1  
GACACAGTCTGCGACGGGACCCGGCGTGCCCATGTGTCAGGTGGGCGAGGACTACGGGGA
HKR442095 RBdS105D23 pGCAP10 NM_001012759.1  
CGGCCGGCCGATGAGTCTGCGACGGGACCCGGCGTGCCCATGTGTCAGGTGGGCGAGGAC
HKR444243 RBdS110K03 pGCAP10 NM_001012759.1  
GACACAGTCTGCGACGGGACCCGGCGTGCCCATGTGTCAGGTGGGCGAGGACTACGGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl