Prev. | 

RIKEN DNA Bank Human Resource - ARPIN

Gene ID NCBI Gene 348110 |  KEGG hsa:348110
Gene Symbol ARPIN
Protein Name actin related protein 2/3 complex inhibitor
Synonyms C15orf38
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX046196 IRAK115I04 pCMV-SPORT6 BC053602 NM_182616

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE082810 M01C007A10 pDONR221 FLJ01-B05 AK055252  
HGE082858 M01C007C10 pDONR221 FLJ01-B05 AK055252  
HGE082906 M01C007E10 pDONR221 FLJ01-B05 AK055252  
HGE082954 M01C007G10 pDONR221 FLJ01-B05 AK055252  
HGE083002 M01C007I10 pDONR221 FLJ01-B05 AK055252  
HGE083050 M01C007K10 pDONR221 FLJ01-B05 AK055252  
HGE083098 M01C007M10 pDONR221 FLJ01-B05 AK055252  
HGE083146 M01C007O10 pDONR221 FLJ01-B05 AK055252  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR234086 ARiS085D14 pGCAP10 NM_182616.2  
GATTCCTGGATCCGCCGGCTGGGAATCGCGGGTCCCCGCGCGTCCTGCAGCACTTCCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl