Prev. |  KEGG KO K15276 > 

RIKEN DNA Bank Human Resource - SLC35B2

Gene ID NCBI Gene 347734 |  KEGG hsa:347734
Gene Symbol SLC35B2
Protein Name solute carrier family 35 member B2
Synonyms PAPST1|SLL|UGTrel4
Ortholog resource in our bank

  SLC35B2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008906 IRAK022E10 pCMV-SPORT6 BC016839 NM_178148 Partial
HGY097006 IRAL042I14 pOTB7 BC024288 NM_178148

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE006958 W01A017G14 pENTR-TOPO IRAL042I14 BC024288 NM_178148  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR063628 ARe59B04 pKA1U5 NM_178148.1  
GGGCCGCTCCTGGAGGCGGCGGCGGGAGCGCAGGGGGCGCGCGGCCCGGGGACTCGCATT
HKR392546 RBd81G02 pGCAP10 NM_178148.1  
GGAGGCGGGAAGAGCGCGGCACTTCCGCTGGCCGCTGGCTCGCTGGCCGCTCCTGGAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl