DNA Bank Top |  KEGG KO K19601 > 

RIKEN DNA Bank Human Resource - EYS

Gene ID NCBI Gene 346007 |  KEGG hsa:346007
Gene Symbol EYS
Protein Name eyes shut homolog
Synonyms C6orf178|C6orf179|C6orf180|EGFL10|EGFL11|RP25|SPAM|bA166P24.2|bA307F22.3|bA74E24.1|dJ1018A4.2|dJ22I17.2|dJ303F19.1

Link

Ortholog resource in our bank

  EYS

External database

human EYS

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB20446 pcDNA3.1-Eys-c8805a Expression vector of human c.8805-truncated EYS cDNA. CMV promoter, bGH polyA.    
RDB20435 pcDNA3.1-Eys-WT Expression vector of human EYS full-length cDNA. CMV promoter, bGH polyA.    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR366973 RBd17H05 pGCAP10 NM_001142800.1 partial done
GAATCAGAAGCCTCCTAGGGTTGCAAGCCTCCTTGGCTAATGGTTGGGCTTTGTGCCTCA
HKR442119 RBdS105E23 pGCAP10 NM_001142800.1  
GAGGCATGTCCAGACATTGACCGTAATCAGAAGCCTCCTAGGGTTGCAAGCCTCCTTGGC
HKR461982 RBdS154P22 pGCAP10 NM_001142800.1  
GATTAACCGTAATCAGAAGCCTCCTAGGGTTGCAAGCCTCCTTGGCTAATGGTTGGGCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

♦ No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
♦ A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
♦ Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
♦ Visualization of Organelles update (Dec 18, 2023)
♦ Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
♦ Autophagy and Mitophagy Updates (Aug 16, 2023)
♦ High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
♦ Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
♦ Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
♦ Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
♦ Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.11.21

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl