Prev. | 

RIKEN DNA Bank Human Resource - AGBL3

Gene ID NCBI Gene 340351 |  KEGG hsa:340351
Gene Symbol AGBL3
Protein Name ATP/GTP binding protein like 3
Synonyms CCP3
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY019071 IRAK047L07 pBluescriptR BC030651 NM_178563 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE090017 M01C025A17 pDONR221 MGC02-A09 BC030651 ENST00000275763  
HGE090065 M01C025C17 pDONR221 MGC02-A09 BC030651 ENST00000275763  
HGE090113 M01C025E17 pDONR221 MGC02-A09 BC030651 ENST00000275763  
HGE090161 M01C025G17 pDONR221 MGC02-A09 BC030651 ENST00000275763  
HGE090209 M01C025I17 pDONR221 MGC02-A09 BC030651 ENST00000275763  
HGE090257 M01C025K17 pDONR221 MGC02-A09 BC030651 ENST00000275763  
HGE090305 M01C025M17 pDONR221 MGC02-A09 BC030651 ENST00000275763  
HGE090353 M01C025O17 pDONR221 MGC02-A09 BC030651 ENST00000275763  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR326524 RBb16F04 pKA1U5 NM_178563.3  
GGCCTGATGACGAGAGTTGGGAGTGTGGCTGGGGCTGCGGATCTCCAGCAGTGGCGTTAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl