Prev. | 

RIKEN DNA Bank Human Resource - ZBTB8OS

Gene ID NCBI Gene 339487 |  KEGG hsa:339487
Gene Symbol ZBTB8OS
Protein Name zinc finger and BTB domain containing 8 opposite strand
Synonyms ARCH|ARCH2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY099539 IRAL048O03 pDNR-LIB BC058843 NM_178547 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE080402 M01C001A02 pDONR221 04-134-2_1-B01 BC058843 NM_178547  
HGE080450 M01C001C02 pDONR221 04-134-2_1-B01 BC058843 NM_178547  
HGE080498 M01C001E02 pDONR221 04-134-2_1-B01 BC058843 NM_178547  
HGE080546 M01C001G02 pDONR221 04-134-2_1-B01 BC058843 NM_178547  
HGE080594 M01C001I02 pDONR221 04-134-2_1-B01 BC058843 NM_178547  
HGE080642 M01C001K02 pDONR221 04-134-2_1-B01 BC058843 NM_178547  
HGE080690 M01C001M02 pDONR221 04-134-2_1-B01 BC058843 NM_178547  
HGE080738 M01C001O02 pDONR221 04-134-2_1-B01 BC058843 NM_178547  
HGE090021 M01C025A21 pDONR221 MGC02-A11 BC058843 NM_178547  
HGE090069 M01C025C21 pDONR221 MGC02-A11 BC058843 NM_178547  
HGE090117 M01C025E21 pDONR221 MGC02-A11 BC058843 NM_178547  
HGE090165 M01C025G21 pDONR221 MGC02-A11 BC058843 NM_178547  
HGE090213 M01C025I21 pDONR221 MGC02-A11 BC058843 NM_178547  
HGE090261 M01C025K21 pDONR221 MGC02-A11 BC058843 NM_178547  
HGE090309 M01C025M21 pDONR221 MGC02-A11 BC058843 NM_178547  
HGE090357 M01C025O21 pDONR221 MGC02-A11 BC058843 NM_178547  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR079203 ARe98A03 pKA1U5 NM_178547.2  
GAAGAGGGCAGCCATTTTCTTGAAGGCTATTAAGCTTACGACCCTTTCAGAGTACTGAGA
HKR169626 ARi24B02 pGCAP10 NM_178547.2  
GAGTCATGGCGCAGGAAGAGGAAGATGTTAGAGATTACAATTTGACTGAAGAACAGAAGG
HKR433446 RBdS083K06 pGCAP10 NM_178547.2  
GAGANNGTCTAATCCTGCAGTCATGGCGCAGGAAGAGGAAGATGTTAGAGATTACAATTT
HKR461942 RBdS154O06 pGCAP10 NM_178547.2  
GGCTCCGCCCCTCCCCCCACGCCTCCCCGAGCCGACTTCCCGCGATTGCGCGCGCCGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl