Prev. | 

RIKEN DNA Bank Human Resource - ADAMTSL5

Gene ID NCBI Gene 339366 |  KEGG hsa:339366
Gene Symbol ADAMTSL5
Protein Name ADAMTS like 5
Synonyms THSD6
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX035414 IRAK088I22 pCMV-SPORT6 BC040620 NM_213604 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE120020 M01C100A20 pDONR221 IMS13-F10 AK131571 ENST00000330475  
HGE120068 M01C100C20 pDONR221 IMS13-F10 AK131571 ENST00000330475  
HGE120116 M01C100E20 pDONR221 IMS13-F10 AK131571 ENST00000330475  
HGE120164 M01C100G20 pDONR221 IMS13-F10 AK131571 ENST00000330475  
HGE120212 M01C100I20 pDONR221 IMS13-F10 AK131571 ENST00000330475  
HGE120260 M01C100K20 pDONR221 IMS13-F10 AK131571 ENST00000330475  
HGE120308 M01C100M20 pDONR221 IMS13-F10 AK131571 ENST00000330475  
HGE120356 M01C100O20 pDONR221 IMS13-F10 AK131571 ENST00000330475  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR182107 ARi55E11 pGCAP10 NM_213604.2  
GGGGGCCGCTCAGGGAGCCGGGACGCGCTGCCTGGGCTCCGCGCAGCTGGGTGTCACAGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl