Prev. |  KEGG KO K15295 > 

RIKEN DNA Bank Human Resource - CPLX4

Gene ID NCBI Gene 339302 |  KEGG hsa:339302
Gene Symbol CPLX4
Protein Name complexin 4
Synonyms CPX-IV|CPXIV
Ortholog resource in our bank

  CPLX4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE117643 M01C094B19 pDONR221 IMS10-G10 AK123184 NM_181654  
HGE117691 M01C094D19 pDONR221 IMS10-G10 AK123184 NM_181654  
HGE117739 M01C094F19 pDONR221 IMS10-G10 AK123184 NM_181654  
HGE117787 M01C094H19 pDONR221 IMS10-G10 AK123184 NM_181654  
HGE117835 M01C094J19 pDONR221 IMS10-G10 AK123184 NM_181654  
HGE117883 M01C094L19 pDONR221 IMS10-G10 AK123184 NM_181654  
HGE117931 M01C094N19 pDONR221 IMS10-G10 AK123184 NM_181654  
HGE117979 M01C094P19 pDONR221 IMS10-G10 AK123184 NM_181654  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR453019 RBdS132J03 pGCAP10 NM_181654.4 full cds  
GACTCTTCTCTATCAGTATGCCCTTGAATAGATGAGGTTGTGCAAAGTCCTTTGCTCTTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl