Prev. |  KEGG KO K14807 > 

RIKEN DNA Bank Human Resource - DDX51

Gene ID NCBI Gene 317781 |  KEGG hsa:317781
Gene Symbol DDX51
Protein Name DEAD-box helicase 51
Synonyms -
Ortholog resource in our bank

  DDX51

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011299 IRAK028E03 pCMV-SPORT6 BC012461 NM_175066 Partial/var
HGY028253 IRAK070K13 pBluescriptR BC040185 NM_175066

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE113236 M01C083B12 pDONR221 IMS05-D06 BC040185 NM_175066  
HGE113284 M01C083D12 pDONR221 IMS05-D06 BC040185 NM_175066  
HGE113332 M01C083F12 pDONR221 IMS05-D06 BC040185 NM_175066  
HGE113380 M01C083H12 pDONR221 IMS05-D06 BC040185 NM_175066  
HGE113428 M01C083J12 pDONR221 IMS05-D06 BC040185 NM_175066  
HGE113476 M01C083L12 pDONR221 IMS05-D06 BC040185 NM_175066  
HGE113524 M01C083N12 pDONR221 IMS05-D06 BC040185 NM_175066  
HGE113572 M01C083P12 pDONR221 IMS05-D06 BC040185 NM_175066  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR444258 RBdS110K18 pGCAP10 NM_175066.4 full/var  
GGGGCGTGCCGCCGACGTCATCGCAGCGCGCCACGCCCGAGTCCCAGGCGTGCGGCTGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl