Prev. | 

RIKEN DNA Bank Human Resource - PAXX

Gene ID NCBI Gene 286257 |  KEGG hsa:286257
Gene Symbol PAXX
Protein Name PAXX, non-homologous end joining factor
Synonyms C9orf142|XLS
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX034847 IRAK087B23 pCMV-SPORT6 BC038191 NM_183241 Partial/var
HGY081932 IRAL004N20 pOTB7 BC002613 NM_183241

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE100024 M01C050A24 pDONR221 MGC14-F12 BC002613 NM_183241  
HGE100072 M01C050C24 pDONR221 MGC14-F12 BC002613 NM_183241  
HGE100120 M01C050E24 pDONR221 MGC14-F12 BC002613 NM_183241  
HGE100168 M01C050G24 pDONR221 MGC14-F12 BC002613 NM_183241  
HGE100216 M01C050I24 pDONR221 MGC14-F12 BC002613 NM_183241  
HGE100264 M01C050K24 pDONR221 MGC14-F12 BC002613 NM_183241  
HGE100312 M01C050M24 pDONR221 MGC14-F12 BC002613 NM_183241  
HGE100360 M01C050O24 pDONR221 MGC14-F12 BC002613 NM_183241  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR048036 ARe20B12 pKA1U5 NM_183241.1  
GGCTCGCCCGGCGCCATGGATCCGCATGTCGCCGCCGCNTCTGCACGCTGCCGCCGGGCC
HKR279234 ARiS198B10 pGCAP10 NM_183241.1  
GGCCCGGCGCCATGGATCCGCNGTCGCCGCCGCTCTGCACGCTGCCGCCGGGCCCCGAGC
HKR279560 ARiS198O24 pGCAP10 NM_183241.1  
GGCCCGGNNNCNNTNNCCGCNNNACGCCGCCGCNCNGCNCGCNGCCGCCGGGCCCCGNGN

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl