Prev. | 

RIKEN DNA Bank Human Resource - TRIQK

Gene ID NCBI Gene 286144 |  KEGG hsa:286144
Gene Symbol TRIQK
Protein Name triple QxxK/R motif containing
Synonyms C8orf83|PRO0845|UPF0599
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE012600 W01A031I08 pENTR-TOPO flj0042f02 AK096398  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR164178 ARi10H10 pGCAP10 NR_015339.1  
GCCCGTGCGCCCTGAGTGACAGAACCGTGGACAGCAACATTTCCCACAGGACACGAAGTT
HKR387259 RBd68C11 pGCAP10 NR_015339.1  
GAGGGGTGTGCGGCTGGCTTGTCCCGCCCCTGCCCCTGAGTGACAGAACCGTGGACAGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl