Prev. | 

RIKEN DNA Bank Human Resource - FAM83H

Gene ID NCBI Gene 286077 |  KEGG hsa:286077
Gene Symbol FAM83H
Protein Name family with sequence similarity 83 member H
Synonyms AI3|AI3A
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY097547 IRAL043O11 pOTB7 BC033256 NM_198488 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE118807 M01C097A07 pDONR221 IMS12-A04 AK127960 ENST00000320563  
HGE118855 M01C097C07 pDONR221 IMS12-A04 AK127960 ENST00000320563  
HGE118903 M01C097E07 pDONR221 IMS12-A04 AK127960 ENST00000320563  
HGE118951 M01C097G07 pDONR221 IMS12-A04 AK127960 ENST00000320563  
HGE118999 M01C097I07 pDONR221 IMS12-A04 AK127960 ENST00000320563  
HGE119047 M01C097K07 pDONR221 IMS12-A04 AK127960 ENST00000320563  
HGE119095 M01C097M07 pDONR221 IMS12-A04 AK127960 ENST00000320563  
HGE119143 M01C097O07 pDONR221 IMS12-A04 AK127960 ENST00000320563  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR076099 ARe90E03 pKA1U5 NM_198488.3  
GAGTGGCTGCCGGACCGACCGGACCGCGAGGCCGCTGGGCGGCGGTCGGCTCCTGCTGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl