Prev. | 

RIKEN DNA Bank Human Resource - DLX6-AS1

Gene ID NCBI Gene 285987 |  KEGG hsa:285987
Gene Symbol DLX6-AS1
Protein Name DLX6 antisense RNA 1
Synonyms DLX6-AS|DLX6AS|Evf-2|NCRNA00212
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR409093 RBdS022M05 pGCAP10 NR_015448.1  
GGGGCGGCTGCGCTGCTGTTGTGGTAGGACTGGAGTTGCTGAGACAAAGGAAAACCCACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl