Prev. | 

RIKEN DNA Bank Human Resource - DCBLD1

Gene ID NCBI Gene 285761 |  KEGG hsa:285761
Gene Symbol DCBLD1
Protein Name discoidin, CUB and LCCL domain containing 1
Synonyms dJ94G16.1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX031813 IRAK079I21 pCMV-SPORT6 BC035671 NM_173674

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR051201 ARe28A01 pKA1U5 NM_173674.1  
GGTCCCGGCGCCGCGCTCGTCCGCAGAGGAGGCGGCCCGGCCCGGGCAGCTGCGGCTCGG
HKR054078 ARe35D06 pKA1U5 NM_173674.1  
GGTCCGCAGAGGAGGCGGCCCGGCCCGGGCAGCTGCGGCTCGGGATCCGTCGAGGGGAGG
HKR164532 ARi11F12 pGCAP10 NM_173674.1  
GANNGAGAGGAGGCGGCCCGGCCCGGGCAGCTGCGGCTCGGGATCCGTCGAGGGGAGGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl