Prev. | 

RIKEN DNA Bank Human Resource - SREK1IP1

Gene ID NCBI Gene 285672 |  KEGG hsa:285672
Gene Symbol SREK1IP1
Protein Name SREK1 interacting protein 1
Synonyms P18SRP|SFRS12IP1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE018824 W01A047A24 pENTR-TOPO flj0016f04 AK094073 NM_173829  
HGE018854 W01A047C06 pENTR-TOPO flj0016f04 AK094073 NM_173829  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR010148 ARa25G04 pKA1U5 NM_173829.3  
GGCTGGGGGAAGGAAAACGCCGCTTTGACTGTGCCTTGTTCTCACAGCTGGCGGGAAGCA
HKR368025 RBd20B01 pGCAP10 NM_173829.3  
TGGGCTTTTTTGACTGTGCCTTGTTCTCACAGCTGGCGGGAAGCAAGCGCCTTTTCGAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl