Prev. | 

RIKEN DNA Bank Human Resource - FAM200B

Gene ID NCBI Gene 285550 |  KEGG hsa:285550
Gene Symbol FAM200B
Protein Name family with sequence similarity 200 member B
Synonyms C4orf53
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY042723 IRAK106N11 pBluescript BC048993 XR_001250
HGY094648 IRAL036K08 pDNR-LIB BC017971 XR_001250

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR058402 ARe46A02 pKA1U5 NM_001145191.1  
TGAGGCGCAGCTCTGCTGGAGAGACCTGAGGCTTGCAGCGCTGGGCCCGGCCGGGTCGCT
HKR222173 ARiS055H05 pGCAP10 NM_001145191.1  
GGAGGCTTGCAGCGCTGGGCCCGGCCGGGTCGCTGCGGCTGGGCTGGAGGTGAGGCNAAA
HKR248940 ARiS122F20 pGCAP10 NM_001145191.1  
GGCAGAGGGCCGATCCAGTTCTTTTCGGCTGGAATGGGGAATTTGTGAGGTAGGCCGGAA
HKR343369 RBb58H01 pGCAP1 NM_001145191.1  
GGCGGAGGGAAGTGTGGGGAGAGCAGAGGCGCAGCTCTGCTGGAGAGACCTGAGGCTTGC
HKR347252 RBb68C04 pGCAP1 NM_001145191.1  
GGTGGGGAGAGCAGAGGCGCAGCTCTGCTGGAGAGACCTGAGGCTTGCAGCGCTGGGCCC
HKR408955 RBdS022G11 pGCAP10 NM_001145191.1  
GGCGGAGGGAAGTGTGGGGAGAGCAGAGGCGCAGCTCTGCTGGAGAGACCTGAGGCTTGC
HKR432732 RBdS081N20 pGCAP10 NM_001145191.1  
GAGANNNNCAGCTCTGCTGGAGAGACCTGAGGCTTGCAGCGCTGGGCCCGGCCGGGTCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl