Prev. | 

RIKEN DNA Bank Human Resource - GPRIN3

Gene ID NCBI Gene 285513 |  KEGG hsa:285513
Gene Symbol GPRIN3
Protein Name GPRIN family member 3
Synonyms GRIN3
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE117606 M01C094A06 pDONR221 IMS10-F03 AK124616 ENST00000333209  
HGE117654 M01C094C06 pDONR221 IMS10-F03 AK124616 ENST00000333209  
HGE117702 M01C094E06 pDONR221 IMS10-F03 AK124616 ENST00000333209  
HGE117750 M01C094G06 pDONR221 IMS10-F03 AK124616 ENST00000333209  
HGE117798 M01C094I06 pDONR221 IMS10-F03 AK124616 ENST00000333209  
HGE117846 M01C094K06 pDONR221 IMS10-F03 AK124616 ENST00000333209  
HGE117894 M01C094M06 pDONR221 IMS10-F03 AK124616 ENST00000333209  
HGE117942 M01C094O06 pDONR221 IMS10-F03 AK124616 ENST00000333209  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR406029 RBdS015B05 pGCAP10 NM_198281.2  
GACTAATAGAGGCGAACTTTGGAACCACATTAAATCAGGGTAGAGACTAGAGGTGATAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl