Prev. | Human A to Z list > G > 

RIKEN DNA Bank Human Resource - GPRIN3

Gene ID (NCBI) 285513
Gene Symbol GPRIN3
Protein Name GPRIN family member 3
Synonyms GRIN3
Databases KEGG hsa:285513 |  NCBI Gene 285513


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE117606 M01C094A06 pDONR221 IMS10-F03 AK124616 ENST00000333209  
HGE117654 M01C094C06 pDONR221 IMS10-F03 AK124616 ENST00000333209  
HGE117702 M01C094E06 pDONR221 IMS10-F03 AK124616 ENST00000333209  
HGE117750 M01C094G06 pDONR221 IMS10-F03 AK124616 ENST00000333209  
HGE117798 M01C094I06 pDONR221 IMS10-F03 AK124616 ENST00000333209  
HGE117846 M01C094K06 pDONR221 IMS10-F03 AK124616 ENST00000333209  
HGE117894 M01C094M06 pDONR221 IMS10-F03 AK124616 ENST00000333209  
HGE117942 M01C094O06 pDONR221 IMS10-F03 AK124616 ENST00000333209  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR406029 RBdS015B05 pGCAP10 NM_198281.2  
GACTAATAGAGGCGAACTTTGGAACCACATTAAATCAGGGTAGAGACTAGAGGTGATAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl