Prev. | 

RIKEN DNA Bank Human Resource - RPUSD3

Gene ID NCBI Gene 285367 |  KEGG hsa:285367
Gene Symbol RPUSD3
Protein Name RNA pseudouridine synthase D3
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY100177 IRAL050H09 pOTB7 BC062362 NM_173659 Full/var
HGY100477 IRAL051D05 pDNR-LIB BC065741 NM_173659 Full/var
HGY095737 IRAL039F17 pOTB7 BC032135 NM_173659

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR348876 RBb72D04 pGCAP1 NM_173659.2  
GGTCCTGGCTCGGGAGATGGACGGCCGCCGTGTTTTGGGCCGGTTCTGGAGTGGCTGGCG
HKR392956 RBd82G12 pGCAP10 NM_173659.2  
TCATGCGCGCTGTCCTGGCTCGGGAGATGGACGGCCGCCGTGTTTTGGGCCGGTTCTGGA
HKR416352 RBdS040O16 pGCAP10 NM_173659.2  
GGCTCGGGAGATGGACGGCCGCCGTGTTTTGGGCCGGTTCTGGAGTGGCTGGCGGCGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl