Prev. |  KEGG KO K13444 > 

RIKEN DNA Bank Human Resource - SUMF1

Gene ID NCBI Gene 285362 |  KEGG hsa:285362
Gene Symbol SUMF1
Protein Name sulfatase modifying factor 1
Synonyms AAPA3037|FGE|UNQ3037
Featured content Lysosome (human)
Ortholog resource in our bank

  SUMF1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE025142 W01A062O06 pENTR-TOPO flj0027n11 AK075459 NM_182760 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR078504 ARe96E08 pKA1U5 NM_182760.2  
GACAACATGGCTGCGCCCGCACTAGGGCTGGTGTGTGGACGTTGCCCTGAGCTGGGTCTC
HKR182001 ARi55A01 pGCAP10 NM_182760.2  
GGGCCCGCGGGACAACATGGCTGCGCCCGCACTAGGGCTGGTGTGTGGACGTTGCCCTGA
HKR188074 ARi70D02 pGCAP10 NM_182760.2  
GGGCCCGCGGGACAACATGGCTGCGCCCGCACTAGGGCTGGTGTGTGGACGTTGCCCTGA
HKR231305 ARiS078E09 pGCAP10 NM_182760.2  
GGGGAAACATGGCTGCGCCCGCACTAGGGCTGGTGTGTGGACGTTGCCCTGAGCTGGGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2023.04.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl