Prev. |  KEGG KO K07933 > 

RIKEN DNA Bank Human Resource - RABL3

Gene ID NCBI Gene 285282 |  KEGG hsa:285282
Gene Symbol RABL3
Protein Name RAB, member of RAS oncogene family like 3
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K07933) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY095111 IRAL037M23 pDNR-LIB BC020832 NM_173825 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE000865 W01A002C17 pENTR-TOPO IRAL037M23 BC020832 NM_173825  
HGE000867 W01A002C19 pENTR-TOPO IRAL037M23 BC020832 NM_173825  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR066010 ARe65A10 pKA1U5 NM_173825.3  
GAGGGAAGGCAGTGGCAAGATGGCGTCCCTGGATCGGGTGAAGGTACTGGTGTTGGGAGA
HKR442319 RBdS105N07 pGCAP10 NM_173825.3  
GAGTGGCAAGATGGCGTCCCTGGATCGGGTGAAGGTACTGGTGTTGGGAGACTCAGGTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl