Prev. | 

RIKEN DNA Bank Human Resource - FRG1BP

Gene ID NCBI Gene 284802 |  KEGG hsa:284802
Gene Symbol FRG1BP
Protein Name FSHD region gene 1 family member B, pseudogene
Synonyms C20orf80|FRG1B|bA348I14.2
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY100612 IRAL051I20 pDNR-LIB BC062724 NM_207350 Partial/var
HGY100634 IRAL051J18 pDNR-LIB BC062743 NM_207350 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE082823 M01C007A23 pDONR221 FLJ01-A12 AK055615 ENST00000376334  
HGE082871 M01C007C23 pDONR221 FLJ01-A12 AK055615 ENST00000376334  
HGE082919 M01C007E23 pDONR221 FLJ01-A12 AK055615 ENST00000376334  
HGE082967 M01C007G23 pDONR221 FLJ01-A12 AK055615 ENST00000376334  
HGE083015 M01C007I23 pDONR221 FLJ01-A12 AK055615 ENST00000376334  
HGE083063 M01C007K23 pDONR221 FLJ01-A12 AK055615 ENST00000376334  
HGE083111 M01C007M23 pDONR221 FLJ01-A12 AK055615 ENST00000376334  
HGE083159 M01C007O23 pDONR221 FLJ01-A12 AK055615 ENST00000376334  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR234949 ARiS087G05 pGCAP10 NR_003579.1  
GATTCNCTGTTTGGGTGAANACCGAGGCGGGTTCTGGACAGACCTACGCTGTCCGGGAGT
HKR370054 RBd25C06 pGCAP10 NR_003579.1  
GACTTCGCCTCCACTTCTGTTCCTCCCCGCCCTGGTGCTGCTCCAGGTCACATACTCTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.08

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl