Prev. |  KEGG KO K18311 > 

RIKEN DNA Bank Human Resource - RIMKLA

Gene ID NCBI Gene 284716 |  KEGG hsa:284716
Gene Symbol RIMKLA
Protein Name ribosomal modification protein rimK like family member A
Synonyms FAM80A|NAAGS|NAAGS-II
Ortholog resource in our bank

  RIMKLA

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033136 IRAK082N24 pCMV-SPORT6 BC039737 NM_173642 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE107216 M01C068A16 pDONR221 06_08-F08 BC039737 ENST00000372570  
HGE107264 M01C068C16 pDONR221 06_08-F08 BC039737 ENST00000372570  
HGE107312 M01C068E16 pDONR221 06_08-F08 BC039737 ENST00000372570  
HGE107360 M01C068G16 pDONR221 06_08-F08 BC039737 ENST00000372570  
HGE107408 M01C068I16 pDONR221 06_08-F08 BC039737 ENST00000372570  
HGE107456 M01C068K16 pDONR221 06_08-F08 BC039737 ENST00000372570  
HGE107504 M01C068M16 pDONR221 06_08-F08 BC039737 ENST00000372570  
HGE107552 M01C068O16 pDONR221 06_08-F08 BC039737 ENST00000372570  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR399211 RBd98A11 pGCAP10 NM_173642.3  
GGCACCCGCGGGAGCGGAGCCGTGGCGCGCTCGCCCCGGACGCCGGCCGCCCCTCCGCTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl