DNA Bank Top |  KEGG KO K13204 > 

RIKEN DNA Bank Human Resource - ZNF326

Gene ID NCBI Gene 284695 |  KEGG hsa:284695
Gene Symbol ZNF326
Protein Name zinc finger protein 326
Synonyms ZAN75|ZIRD|Zfp326|dJ871E2.1

Link

Ortholog resource in our bank

  ZNF326

External database

human ZNF326

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB04461 SEREX clone BRC-Co-59 #1 SEREX clone BRC-Co-59 #1    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX046367 IRAK115P07 pCMV-SPORT6 BC052645 NM_182975 Full
HGX006224 IRAK015J08 pCMV-SPORT6 BC014899 NM_182975 Partial
HGY102971 IRAL057H03 pDNR-LIB BC070341 NM_182975 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2024May11.csv
GNP_full_IRAL_2024May11.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE038751 W01A096O15 pENTR-TOPO flj0062f23 AK000410 NM_182975  
HGE038757 W01A096O21 pENTR-TOPO flj0062f23 AK000410 NM_182975  
HGE047468 W01A118L04 pENTR-TOPO flj0062f23 AK000410 NM_182975  
HGE047470 W01A118L06 pENTR-TOPO flj0062f23 AK000410 NM_182975  
HGE047472 W01A118L08 pENTR-TOPO flj0062f23 AK000410 NM_182975  
HGE047474 W01A118L10 pENTR-TOPO flj0062f23 AK000410 NM_182975  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR371306 RBd28E10 pGCAP10 NM_181781.2  
GAGCGCGCCGCTCTCGGTCGCGCGGAGTGATCGTGTGGAATCGCGGGTCGCGGACGCTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv

2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl