RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - ZNF763

Gene ID	NCBI Gene 284390 \| KEGG hsa:284390
Gene Symbol	ZNF763
Protein Name	zinc finger protein 763
Synonyms	ZNF\|ZNF440L

Ortholog resource in our bank

  ZNF763

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR078173	ARe95H05	pKA1U5	NM_001012753.1
HKR078173	GGTTTATCCAGGCACAGAGTGGGTCGCATTCCTGCTCNTCACCTTTGGTCCTTGCGCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl