RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - PPP1R37

Gene ID	NCBI Gene 284352 \| KEGG hsa:284352
Gene Symbol	PPP1R37
Protein Name	protein phosphatase 1 regulatory subunit 37
Synonyms	LRRC68

Ortholog resource in our bank

  PPP1R37

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGX031654	IRAK079C06	pCMV-SPORT6	BC035704

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR165331	ARi13F11	pGCAP10	XM_001723010.1
HKR165331	GGCGCTTGGGCTCCCGGCGGCGACGACTACGACCACTAGGAGAGCGGACGGAGGCGGCGC
HKR203464	ARiS008K24	pGCAP10	XM_001723010.1
HKR203464	GGCGCTTGGGCTCCCGGCGGCGACGACTACGACCACTAGGAGAGCGGACGGAGGCGGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl