Prev. | 

RIKEN DNA Bank Human Resource - ZNF776

Gene ID NCBI Gene 284309 |  KEGG hsa:284309
Gene Symbol ZNF776
Protein Name zinc finger protein 776
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR334103 RBb35E07 pGCAP1 NM_173632.2  
GAGTGGCCATTTTGATTGGTGTTGGGTGTATTTTCCAGTGAGAGACCGCGGAGTGTTGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl