Prev. |  KEGG KO K14708 > 

RIKEN DNA Bank Human Resource - SLC26A11

Gene ID NCBI Gene 284129 |  KEGG hsa:284129
Gene Symbol SLC26A11
Protein Name solute carrier family 26 member 11
Synonyms -
Ortholog resource in our bank

  SLC26A11

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX031412 IRAK078I20 pCMV-SPORT6 BC035900 NM_173626 Full/var
HGX008862 IRAK022C14 pCMV-SPORT6 BC015160 NM_173626
HGY036660 IRAK091K20 pBluescript BC047451 NM_173626 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR387706 RBd69E10 pGCAP10 NM_173626.2  
GCTGTCCCCGGCGATTCCTGCGGACCCAGCTGCGGCGACGCCAGGAGACCCCAAGCTGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl