Prev. | 

RIKEN DNA Bank Human Resource - CISD3

Gene ID NCBI Gene 284106 |  KEGG hsa:284106
Gene Symbol CISD3
Protein Name CDGSH iron sulfur domain 3
Synonyms MiNT|Miner2
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR235347 ARiS088G03 pGCAP10 NM_001136498.1  
GGGGCGGAGCCAGCGGGCGGGCGCGGCGCGGGAGGCGACCATGCGCGGCGCGGGGGCGAT
HKR235509 ARiS088M21 pGCAP10 NM_001136498.1  
GGGGCGGAGCCAGCGGGCGGGCGCGGCGCGGGAGGCGACCATGCGCGGCGCGGGGGCGAT
HKR441863 RBdS104K23 pGCAP10 NM_001136498.1  
TTGACGCCCGGCGTGCTGAGGAGGCCGCTGGGCGGGCGCCGTGGTCGGGCTTCCGTACCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl