Prev. | 

RIKEN DNA Bank Human Resource - FAM171A2

Gene ID NCBI Gene 284069 |  KEGG hsa:284069
Gene Symbol FAM171A2
Protein Name family with sequence similarity 171 member A2
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX019652 IRAK049C04 pCMV-SPORT6 BC030200 XM_937866 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR074924 ARe87F04 pKA1U5 NM_198475.2  
GGCGCTGAGCGGGCGCCGCAGCGGGAGCGGGAGCCGGAGCTGCGAGGCGCGGCGCAGAGC
HKR334132 RBb35F12 pGCAP1 NM_198475.2  
GGAGCGGGACCAGGCGGGAGCCATGGTACCGCTAGGGCCCGGCCTAGCCCCGCGATGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl