Prev. | 

RIKEN DNA Bank Human Resource - UBALD2

Gene ID NCBI Gene 283991 |  KEGG hsa:283991
Gene Symbol UBALD2
Protein Name UBA like domain containing 2
Synonyms FAM100B
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY053239 IRAK133B15 pBluescript BC060859 NM_182565 Full
HGY095980 IRAL039P20 pOTB7 BC035511 NM_182565

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE100818 M01C052A18 pDONR221 MGC15-F09 BC035511 ENST00000327490  
HGE100866 M01C052C18 pDONR221 MGC15-F09 BC035511 ENST00000327490  
HGE100914 M01C052E18 pDONR221 MGC15-F09 BC035511 ENST00000327490  
HGE100962 M01C052G18 pDONR221 MGC15-F09 BC035511 ENST00000327490  
HGE101010 M01C052I18 pDONR221 MGC15-F09 BC035511 ENST00000327490  
HGE101058 M01C052K18 pDONR221 MGC15-F09 BC035511 ENST00000327490  
HGE101106 M01C052M18 pDONR221 MGC15-F09 BC035511 ENST00000327490  
HGE101154 M01C052O18 pDONR221 MGC15-F09 BC035511 ENST00000327490  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR208152 ARiS020G08 pGCAP10 NM_182565.3  
HKR330497 RBb26E01 pGCAP1 NM_182565.3  
GGGAGTCGAACCACAACATTCGCCGGGCGGGCGGCGGCGGAGCGGGCGGCGGAGCGGCGG
HKR362906 RBd07E10 pGCAP10 NM_182565.3  
GTTTGTTTTTGGTGTCNCCCGGGACCCGGGAGTCCAACNNNNACATTCNCCGGGCGGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl