Prev. |  KEGG KO K11669 > 

RIKEN DNA Bank Human Resource - INO80E

Gene ID NCBI Gene 283899 |  KEGG hsa:283899
Gene Symbol INO80E
Protein Name INO80 complex subunit E
Synonyms CCDC95
Ortholog resource in our bank

  INO80E

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX031947 IRAK079O11 pCMV-SPORT6 BC035693 NM_173618 Partial/var
HGX039483 IRAK098L19 pCMV-SPORT6 BC047712 NM_173618 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR122951 ARh07G07 pGCAP1 NM_173618.1  
AAATGTGACGGCAGCCACTGCTTGGGGTAGCGGGAGGGCAGACTCTGGG
HKR398553 RBd96G09 pGCAP10 NM_173618.1  
GACAGCCTTGCAGCGTCTCCGGAAGTGGAGGCGGGAGCGGCACGGCAGCCACTGCTTGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl