Prev. |  KEGG KO K02435 > 

RIKEN DNA Bank Human Resource - GATC

Gene ID NCBI Gene 283459 |  KEGG hsa:283459
Gene Symbol GATC
Protein Name glutamyl-tRNA amidotransferase subunit C
Synonyms 15E1.2
Ortholog resource in our bank

  GATC

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY013266 IRAK033C18 pBluescriptR BC034962 NM_176818 Full/var
HGX039519 IRAK098N07 pCMV-SPORT6 BC047778 NM_176818 Full/var
HGX055713 IRAK139E17 pCMV-SPORT6 BC064523 NM_176818 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR218362 ARiS045P02 pGCAP10 NM_176818.1  
GACGCGCGGGCGCACTGCGGGGGCCAAGGAAGGAAGAAATGTGGTCGCGGTTGGTGTGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl