Prev. |  KEGG KO K16750 > 

RIKEN DNA Bank Human Resource - BLOC1S2

Gene ID NCBI Gene 282991 |  KEGG hsa:282991
Gene Symbol BLOC1S2
Protein Name biogenesis of lysosomal organelles complex 1 subunit 2
Synonyms BLOS2|BORCS2|CEAP|CEAP11
Ortholog resources KEGG ortholog (KEGG orthology K16750) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005936 IRAK014N24 pCMV-SPORT6 BC020494 NM_001001342 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR330056 RBb25C08 pGCAP1 NM_173809.2  
GAGCGCGGGGTCCGCTATGGCGGCGGCAGCCGAGGGCGTACTGGCGACCCGGAGTGATGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl