RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - STK32C

Gene ID	NCBI Gene 282974 \| KEGG hsa:282974
Gene Symbol	STK32C
Protein Name	serine/threonine kinase 32C
Synonyms	PKE\|YANK3
Featured content	Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.

Ortholog resource in our bank

  STK32C

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	CDS comparison
Catalog number	Clone name	Vector	Sequence submitted (DDBJ)⁽¹⁾	Refered (NCBI mRNA)	CDS status⁽²⁾
HGY036227	IRAK090J11	pBluescript	BC045760	NM_173575	Partial/var
HGY093819	IRAL034J03	pOTB7	BC015792	NM_173575	Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR372082	RBd30D10	pGCAP10	NM_173575.2
HKR372082	GAGAGCGCACGGCGGGCGCTGCCGGCCCCGAGCGCTCCCGCTACCACTGCCGCTCCCGGC
HKR381723	RBd54F03	pGCAP10	NM_173575.2
HKR381723	GGCCTTGAAGGGGTGGTGGCCGACGGGCAAGTAGAGACCGCNNNNNTCTGGAGGGGCGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl