Prev. |  KEGG KO K08793 > 

RIKEN DNA Bank Human Resource - STK32C

Gene ID NCBI Gene 282974 |  KEGG hsa:282974
Gene Symbol STK32C
Protein Name serine/threonine kinase 32C
Synonyms PKE|YANK3
Ortholog resources KEGG ortholog (KEGG orthology K08793) in the DNA Bank
Featured content Kinases Included in Myristoylated Kinase Library (human) in Boehm JS Cell 129 (6):1065-1079 (2007). PMID: 17574021.
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY036227 IRAK090J11 pBluescript BC045760 NM_173575 Partial/var
HGY093819 IRAL034J03 pOTB7 BC015792 NM_173575 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR372082 RBd30D10 pGCAP10 NM_173575.2  
GAGAGCGCACGGCGGGCGCTGCCGGCCCCGAGCGCTCCCGCTACCACTGCCGCTCCCGGC
HKR381723 RBd54F03 pGCAP10 NM_173575.2  
GGCCTTGAAGGGGTGGTGGCCGACGGGCAAGTAGAGACCGCNNNNNTCTGGAGGGGCGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl