Prev. | 

RIKEN DNA Bank Human Resource - BRD3OS

Gene ID NCBI Gene 266655 |  KEGG hsa:266655
Gene Symbol BRD3OS
Protein Name BRD3 opposite strand
Synonyms LINC00094|LP2477|NCRNA00094
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR055628 ARe39B04 pKA1U5 NR_015427.2  
GGGCCCCGCCCTGGGAGCCCCGCAGTGCGTCGCGCCGCTGCCCGCATCTCCGAGGCCCGC
HKR276632 ARiS191J16 pGCAP10 NR_015427.2  
GGCAGTGCGTCGCGCCGCTGCCCGCATCTCCGAGGCCCGCGACGAGCGGGGCCTCACGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl