Prev. | 

RIKEN DNA Bank Human Resource - FAM133B

Gene ID NCBI Gene 257415 |  KEGG hsa:257415
Gene Symbol FAM133B
Protein Name family with sequence similarity 133 member B
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX025786 IRAK064H18 pCMV-SPORT6 BC032461 NM_152789 Full
HGY053571 IRAK133P11 pBluescript BC057771 NM_001040057 Full
HGY103769 IRAL059H01 pOTB7 BC079834 NM_002699.4 Partial
HGY100594 IRAL051I02 pDNR-LIB BC062706 NM_152789 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR324505 RBb11E09 pKA1U5 NM_152789.2  
TGGGAGTGGGGAGGCGGCAAGAGGACCTGCGGCNGGCCCTCTTCGGCAGTCTCTCCGGCC
HKR402819 RBdS007A19 pGCAP10 NM_152789.2  
GAGTGGGGAGGCGGCAAGAGGACCTGCGGCAGGCCCTCTTCGGCAGTCTCTCCGGCCCGG
HKR444156 RBdS110G12 pGCAP10 NM_152789.2  
GAGGCCCTCTTCGGCAGTCTCTCCGGCCCGGTTTCCCTCGGCGTGCTACTGTGCGCTCGA
HKR475062 RBdS187K22 pGCAP10 NM_152789.2  
GAGGCGGAGTGGGGAGGCGGCAAGAGGACCTGCGGCAGGCCCTCTTCGGCAGTCTCTCCG
HKR475082 RBdS187L18 pGCAP10 NM_152789.2  
GAGGCGGAGTGGGGAGGCGGCAAGAGGACCTGCGGCAGGCCCTCTTCGGCAGTCTCTCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.07.06

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl