Prev. | 

RIKEN DNA Bank Human Resource - SUN3

Gene ID NCBI Gene 256979 |  KEGG hsa:256979
Gene Symbol SUN3
Protein Name Sad1 and UNC84 domain containing 3
Synonyms SUNC1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY018557 IRAK046G13 pBluescriptR BC026189 NM_152782 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE089643 M01C024B19 pDONR221 MGC01-G10 BC026189 ENST00000381040  
HGE089691 M01C024D19 pDONR221 MGC01-G10 BC026189 ENST00000381040  
HGE089739 M01C024F19 pDONR221 MGC01-G10 BC026189 ENST00000381040  
HGE089787 M01C024H19 pDONR221 MGC01-G10 BC026189 ENST00000381040  
HGE089835 M01C024J19 pDONR221 MGC01-G10 BC026189 ENST00000381040  
HGE089883 M01C024L19 pDONR221 MGC01-G10 BC026189 ENST00000381040  
HGE089931 M01C024N19 pDONR221 MGC01-G10 BC026189 ENST00000381040  
HGE089979 M01C024P19 pDONR221 MGC01-G10 BC026189 ENST00000381040  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR174029 ARi35B05 pGCAP10 NM_152782.3  
GAGTGAGCGGAGATCACGCCACTGCTCTCCAGCCTGGGTGACGAGAGCGAAACTCCATCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl