Prev. | 

RIKEN DNA Bank Human Resource - MAMDC2

Gene ID NCBI Gene 256691 |  KEGG hsa:256691
Gene Symbol MAMDC2
Protein Name MAM domain containing 2
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY095476 IRAL038L12 pDNR-LIB BC016383 NM_153267 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE080846 M01C002B22 pDONR221 04-134-2_1-H11 BC063634 ENST00000377182  
HGE080894 M01C002D22 pDONR221 04-134-2_1-H11 BC063634 ENST00000377182  
HGE080942 M01C002F22 pDONR221 04-134-2_1-H11 BC063634 ENST00000377182  
HGE080990 M01C002H22 pDONR221 04-134-2_1-H11 BC063634 ENST00000377182  
HGE081038 M01C002J22 pDONR221 04-134-2_1-H11 BC063634 ENST00000377182  
HGE081086 M01C002L22 pDONR221 04-134-2_1-H11 BC063634 ENST00000377182  
HGE081134 M01C002N22 pDONR221 04-134-2_1-H11 BC063634 ENST00000377182  
HGE081182 M01C002P22 pDONR221 04-134-2_1-H11 BC063634 ENST00000377182  
HGE095645 M01C039B21 pDONR221 MGC09-C11 BC063634 ENST00000377182  
HGE095693 M01C039D21 pDONR221 MGC09-C11 BC063634 ENST00000377182  
HGE095741 M01C039F21 pDONR221 MGC09-C11 BC063634 ENST00000377182  
HGE095789 M01C039H21 pDONR221 MGC09-C11 BC063634 ENST00000377182  
HGE095837 M01C039J21 pDONR221 MGC09-C11 BC063634 ENST00000377182  
HGE095885 M01C039L21 pDONR221 MGC09-C11 BC063634 ENST00000377182  
HGE095933 M01C039N21 pDONR221 MGC09-C11 BC063634 ENST00000377182  
HGE095981 M01C039P21 pDONR221 MGC09-C11 BC063634 ENST00000377182  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR172555 ARi31G11 pGCAP10 NM_153267.3  
GGCAGTTGTCTCCTCCCTGTCCAGCCCCATCGTCGCCCAGGACCAGCTGGGCCGCGGTCT
HKR219651 ARiS049C03 pGCAP10 NM_153267.3  
TAAATTTTCCTCCAGGCTGTCCTTGGAGAATTCCACCCTCTTTCATTCTGGGGAGAAGAA
HKR277884 ARiS194L20 pGCAP10 NM_153267.3  
GAGTCGTGGCTGGCCTTTCAAAGTGTGCAGTTGTCTCCTCCCTGTCCAGCCCCATCGTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl