Prev. |  KEGG KO K08077 > 

RIKEN DNA Bank Human Resource - NUDT14

Gene ID NCBI Gene 256281 |  KEGG hsa:256281
Gene Symbol NUDT14
Protein Name nudix hydrolase 14
Synonyms UGPP|UGPPase
Ortholog resource in our bank

  NUDT14

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY097718 IRAL044E22 pOTB7 BC041584 NM_177533 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR175331 ARi38F11 pGCAP10 NM_177533.2  
TGATTCACCCGCCCGAAGGCTCCTGTCGGGACAGGGTTGCGCCCCGTGTCGGCCCCCGCC
HKR387375 RBd68H07 pGCAP10 NM_177533.2  
GAGACCNNNGGTCACGCGCCCGCCCGAAGGCTCCTGTCGGGACAGGGCGCCGCCCCGTGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl