Prev. |  KEGG KO K11975 > 

RIKEN DNA Bank Human Resource - RNF144B

Gene ID NCBI Gene 255488 |  KEGG hsa:255488
Gene Symbol RNF144B
Protein Name ring finger protein 144B
Synonyms IBRDC2|PIR2|bA528A10.3|p53RFP
Ortholog resource in our bank

  RNF144B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY053208 IRAK133A08 pBluescript BC063311 NM_182757 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR165306 ARi13E10 pGCAP10 NM_182757.2  
GGCAGTCTTGCAAAGTGTAAAGCTGTCAGCCGCAGAGCACGGAGGAAAGACGGAGAGAAT
HKR222272 ARiS055L08 pGCAP10 NM_182757.2  
TGGANCTNTGCCCCACCCTCCCGCTGCAACAGTCCCGGGCATCGCAGCTGCCAGTCAAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl