Prev. | 

RIKEN DNA Bank Human Resource - TMEM256

Gene ID NCBI Gene 254863 |  KEGG hsa:254863
Gene Symbol TMEM256
Protein Name transmembrane protein 256
Synonyms C17orf61
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025161 IRAK062P01 pCMV-SPORT6 BC030270 NM_152766

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE045116 W01A112N04 pENTR-TOPO IRAK062P01 BC030270 NM_152766  
HGE045124 W01A112N12 pENTR-TOPO IRAK062P01 BC030270 NM_152766  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR047203 ARe18A03 pKA1U5 NM_152766.2  
GGTCCTGTTCTACAGCTATGGCCGGGCCAGCTGCAGCTTTCCGCCGCTTGGGCGCCTTGT
HKR050832 ARe27B08 pKA1U5 NM_152766.2  
GGGCGTTGGTCCGGTGCGTCCTGTTCTACAGCTATGGCCGGGCCAGCTGCAGCTTTCCGC
HKR064107 ARe60E11 pKA1U5 NM_152766.2  
GCTGTTCTACAGCTATGGCCGGGCCAGCTGCAGCTTTCCGCCGCTTGGGCGCCTTGTCCG
HKR065612 ARe64A12 pKA1U5 NM_152766.2  
GGTCCTGTTCTACAGCTATGGCCGGGCCAGCTCCATTATTTCCGCCGCTTGGGCGCCTTG
HKR068907 ARe72E11 pKA1U5 NM_152766.2  
GGTTCTACAGCTATGGCCGGGCCAGCTGCAGCTTTCCGCCGCTTGGGCGCCTTGTCCGGA
HKR074549 ARe86G05 pKA1U5 NM_152766.2  
TGGGATTGGGGGCGGTCAGGGCTGGCACTAGGACCGCTAACCTTTGCTTCTTTTCTCCAC
HKR184477 ARi61D05 pGCAP10 NM_152766.2  
GGACCGCTAACCTTTGCTTCTTTTCTCCACAGGCGCCCAATTCCCAGATGCCTACGGGAA
HKR218337 ARiS045O01 pGCAP10 NM_152766.2  
GGGCNGGCTTGCCTTGGCTCTTTGAGCTCCCTTTTGCTTAATTACTGGGTTTTCTGGGCA
HKR279406 ARiS198I14 pGCAP10 NM_152766.2  
GCTGTTCTACAGCTATGGCCGGGCCAGCTGCAGCTTTCCGCCGCTTGGGCGCCTTGTCCG
HKR385609 RBd64A09 pGCAP10 NM_152766.2  
GCTGTTCTACAGCTATGGCCGGGCCAGCTGCAGCTTTCCGCCGCTTGGGCGCCTTGTCCG
HKR430356 RBdS075O20 pGCAP10 NM_152766.2  
GGTTCTACAGCTATGGCCGGGCCAGCTGCAGCTTTCCGCCGCTTGGGCGCCTTGTCCGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl