Prev. | 

RIKEN DNA Bank Human Resource - PHYHD1

Gene ID NCBI Gene 254295 |  KEGG hsa:254295
Gene Symbol PHYHD1
Protein Name phytanoyl-CoA dioxygenase domain containing 1
Synonyms -
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX046081 IRAK115D09 pCMV-SPORT6 BC053853 NM_174933 Full/var
HGY090481 IRAL026D09 pOTB7 BC009373 NM_174933
HGY098854 IRAL047C06 pOTB7 BC051300 NM_174933 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE110425 M01C076B01 pDONR221 06-2_01-G01 BC009373 ENST00000340161  
HGE110473 M01C076D01 pDONR221 06-2_01-G01 BC009373 ENST00000340161  
HGE110521 M01C076F01 pDONR221 06-2_01-G01 BC009373 ENST00000340161  
HGE110569 M01C076H01 pDONR221 06-2_01-G01 BC009373 ENST00000340161  
HGE110617 M01C076J01 pDONR221 06-2_01-G01 BC009373 ENST00000340161  
HGE110665 M01C076L01 pDONR221 06-2_01-G01 BC009373 ENST00000340161  
HGE110713 M01C076N01 pDONR221 06-2_01-G01 BC009373 ENST00000340161  
HGE110761 M01C076P01 pDONR221 06-2_01-G01 BC009373 ENST00000340161  
HGE099220 M01C048A20 pDONR221 MGC13-F10 BC009373 ENST00000340161  
HGE099268 M01C048C20 pDONR221 MGC13-F10 BC009373 ENST00000340161  
HGE099316 M01C048E20 pDONR221 MGC13-F10 BC009373 ENST00000340161  
HGE099364 M01C048G20 pDONR221 MGC13-F10 BC009373 ENST00000340161  
HGE099412 M01C048I20 pDONR221 MGC13-F10 BC009373 ENST00000340161  
HGE099460 M01C048K20 pDONR221 MGC13-F10 BC009373 ENST00000340161  
HGE099508 M01C048M20 pDONR221 MGC13-F10 BC009373 ENST00000340161  
HGE099556 M01C048O20 pDONR221 MGC13-F10 BC009373 ENST00000340161  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR176827 ARi42B03 pGCAP10 NM_174933.3  
CGGCCGGCCGATGAGTGCCCTGAGCGTCTCCATGGCCTGCCTGAGCCCCTCGCAGCTCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl