Prev. |  KEGG KO K10310 > 

RIKEN DNA Bank Human Resource - FBXO33

Gene ID NCBI Gene 254170 |  KEGG hsa:254170
Gene Symbol FBXO33
Protein Name F-box protein 33
Synonyms BMND12|Fbx33|c14_5247
Ortholog resource in our bank

  FBXO33

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011857 IRAK029K17 pCMV-SPORT6 BC042535 NM_203301 Partial
HGY013642 IRAK034B18 pBluescriptR BC030611 NM_203301 Full/var
HGX046067 IRAK115C19 pCMV-SPORT6 BC053537 NM_203301
HGY067121 IRAK167N09 pBluescriptR BC068566 NM_203301 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE113615 M01C084A15 pDONR221 IMS05-E08 BC053537 NM_203301  
HGE113663 M01C084C15 pDONR221 IMS05-E08 BC053537 NM_203301  
HGE113711 M01C084E15 pDONR221 IMS05-E08 BC053537 NM_203301  
HGE113759 M01C084G15 pDONR221 IMS05-E08 BC053537 NM_203301  
HGE113807 M01C084I15 pDONR221 IMS05-E08 BC053537 NM_203301  
HGE113855 M01C084K15 pDONR221 IMS05-E08 BC053537 NM_203301  
HGE113903 M01C084M15 pDONR221 IMS05-E08 BC053537 NM_203301  
HGE113951 M01C084O15 pDONR221 IMS05-E08 BC053537 NM_203301  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR170829 ARi27B05 pGCAP10 NM_203301.2  
CGGCCGGCCGATGGTCAGTGCCGCAGCCCCGACCGCCGGGAGCTCGAACCCGAGCCGGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl