RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - METAP1D

Gene ID	NCBI Gene 254042 \| KEGG hsa:254042
Gene Symbol	METAP1D
Protein Name	methionyl aminopeptidase type 1D, mitochondrial
Synonyms	MAP 1D\|MAP1D\|MetAP 1D\|Metap1l

Ortholog resource in our bank

  METAP1D

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR332099	RBb30E03	pGCAP1	NM_199227.1	VA
HKR332099	GGCTCGCGGCCACGTGACCGACGCCAACATGGCGGCGCCCAGTGGCGTCCACCTGCTCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl