Prev. |  KEGG KO K01265 > 

RIKEN DNA Bank Human Resource - METAP1D

Gene ID NCBI Gene 254042 |  KEGG hsa:254042
Gene Symbol METAP1D
Protein Name methionyl aminopeptidase type 1D, mitochondrial
Synonyms MAP 1D|MAP1D|MetAP 1D|Metap1l
Ortholog resources KEGG ortholog (KEGG orthology K01265) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR332099 RBb30E03 pGCAP1 NM_199227.1  
GGCTCGCGGCCACGTGACCGACGCCAACATGGCGGCGCCCAGTGGCGTCCACCTGCTCGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl