Prev. | 

RIKEN DNA Bank Human Resource - ASPHD1

Gene ID NCBI Gene 253982 |  KEGG hsa:253982
Gene Symbol ASPHD1
Protein Name aspartate beta-hydroxylase domain containing 1
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX004905 IRAK012E09 pCMV-SPORT6 BC034275 NM_181718 Partial/var
HGX005032 IRAK012J16 pCMV-SPORT6 BC009033 NM_181718 Partial
HGX020166 IRAK050G22 pCMV-SPORT6 BC029136 NM_181718 Partial
HGX035233 IRAK088B09 pCMV-SPORT6 BC040933 NM_181718 Partial
HGY103881 IRAL059L17 pOTB7 BC085011 NM_181718 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR064473 ARe61D01 pKA1U5 NM_181718.3  
GGAGCCCAGGAAGGAGCGAGTAGGAGAGAGGGANCGTAGAGCCAGGCAGGACCGCAGGGT
HKR163373 ARi08H05 pGCAP10 NM_181718.3  
GAGGGTGAGTGGGAGCCCAGGAAGGAGCGAGTAGGAGAGAGGGAGCGAGAGCCAGGCAGG
HKR208361 ARiS020P01 pGCAP10 NM_181718.3  
GGGAGCGAGTAGGAGAGAGGGAGCGAGAGCCAGGCAGGACCGCAGGGTCGGGGCTAGTGA
HKR249180 ARiS122P20 pGCAP10 NM_181718.3  
GAGGCAGGACCGCAGGGTCGGGGCTAGTGAGGAGCGAGGGCAAGGAGAGAGCAGTGAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl