Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ASPHD1

Gene ID (NCBI) 253982
Gene Symbol ASPHD1
Protein Name aspartate beta-hydroxylase domain containing 1
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX004905 IRAK012E09 pCMV-SPORT6 BC034275 NM_181718 Partial/var
HGX005032 IRAK012J16 pCMV-SPORT6 BC009033 NM_181718 Partial
HGX020166 IRAK050G22 pCMV-SPORT6 BC029136 NM_181718 Partial
HGX035233 IRAK088B09 pCMV-SPORT6 BC040933 NM_181718 Partial
HGY103881 IRAL059L17 pOTB7 BC085011 NM_181718 Partial

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR163373 ARi08H05 pGCAP10 NM_181718.3  
GAGGGTGAGTGGGAGCCCAGGAAGGAGCGAGTAGGAGAGAGGGAGCGAGAGCCAGGCAGG
HKR064473 ARe61D01 pKA1U5 NM_181718.3  
GGAGCCCAGGAAGGAGCGAGTAGGAGAGAGGGANCGTAGAGCCAGGCAGGACCGCAGGGT
HKR208361 ARiS020P01 pGCAP10 NM_181718.3  
GGGAGCGAGTAGGAGAGAGGGAGCGAGAGCCAGGCAGGACCGCAGGGTCGGGGCTAGTGA
HKR249180 ARiS122P20 pGCAP10 NM_181718.3  
GAGGCAGGACCGCAGGGTCGGGGCTAGTGAGGAGCGAGGGCAAGGAGAGAGCAGTGAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.29

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl