Prev. |  KEGG KO K19923 > 

RIKEN DNA Bank Human Resource - SPESP1

Gene ID NCBI Gene 246777 |  KEGG hsa:246777
Gene Symbol SPESP1
Protein Name sperm equatorial segment protein 1
Synonyms ESP|SP-ESP
Ortholog resource in our bank

  SPESP1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY094123 IRAL035F03 pDNR-LIB BC017998 NM_145658 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE096813 M01C042A13 pDONR221 MGC10-E07 BC017998 NM_145658  
HGE096861 M01C042C13 pDONR221 MGC10-E07 BC017998 NM_145658  
HGE096909 M01C042E13 pDONR221 MGC10-E07 BC017998 NM_145658  
HGE096957 M01C042G13 pDONR221 MGC10-E07 BC017998 NM_145658  
HGE097005 M01C042I13 pDONR221 MGC10-E07 BC017998 NM_145658  
HGE097053 M01C042K13 pDONR221 MGC10-E07 BC017998 NM_145658  
HGE097101 M01C042M13 pDONR221 MGC10-E07 BC017998 NM_145658  
HGE097149 M01C042O13 pDONR221 MGC10-E07 BC017998 NM_145658  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR180875 ARi52D03 pGCAP10 NM_145658.2  
GGCTTGCGCGCTGGGGACAACCGTTGCTGGGTGTCCCAGGGCCTGAGGCAGGACGGTACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl