Prev. |  KEGG KO K03359 > 

RIKEN DNA Bank Human Resource - CDC26

Gene ID NCBI Gene 246184 |  KEGG hsa:246184
Gene Symbol CDC26
Protein Name cell division cycle 26
Synonyms ANAPC12|APC12|C9orf17
Ortholog resources KEGG ortholog (KEGG orthology K03359) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011852 IRAK029K12 pCMV-SPORT6 BC042534 NM_139286 Full
HGY067005 IRAK167I13 pBluescriptR BC066300 NM_139286 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR205231 ARiS013B07 pGCAP10 NM_139286.3  
GATGATGGAAGTCGTAGTAGGAAATGGCGTCGTGGCATTGAGGGGCATCCCTCCTAGAAC
HKR366925 RBd17F05 pGCAP10 NM_139286.3  
GGGGGCTAGGCCGGCTTGAAAAGAGATTATGACTGTACCTTTTAACTTTGTAGCTGGAAC
HKR366969 RBd17H01 pGCAP10 NM_139286.3  
GGAGGCCGCGGGCGCGAGACTGGGAATGCGCAGGGCCCCCGCCTGGCTCTACAAGCCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl