Prev. |  KEGG KO K03359 > 

RIKEN DNA Bank Human Resource - CDC26

Gene ID NCBI Gene 246184 |  KEGG hsa:246184
Gene Symbol CDC26
Protein Name cell division cycle 26
Synonyms ANAPC12|APC12|C9orf17
Ortholog resource in our bank

  CDC26

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011852 IRAK029K12 pCMV-SPORT6 BC042534 NM_139286 Full
HGY067005 IRAK167I13 pBluescriptR BC066300 NM_139286 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR205231 ARiS013B07 pGCAP10 NM_139286.3  
GATGATGGAAGTCGTAGTAGGAAATGGCGTCGTGGCATTGAGGGGCATCCCTCCTAGAAC
HKR366925 RBd17F05 pGCAP10 NM_139286.3  
GGGGGCTAGGCCGGCTTGAAAAGAGATTATGACTGTACCTTTTAACTTTGTAGCTGGAAC
HKR366969 RBd17H01 pGCAP10 NM_139286.3  
GGAGGCCGCGGGCGCGAGACTGGGAATGCGCAGGGCCCCCGCCTGGCTCTACAAGCCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl