RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - ZNRF2

Gene ID	NCBI Gene 223082 \| KEGG hsa:223082
Gene Symbol	ZNRF2
Protein Name	zinc and ring finger 2
Synonyms	RNF202

Ortholog resource in our bank

  ZNRF2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR068124	ARe70F04	pKA1U5	NM_147128.3
HKR068124	GCTCCCGCCAGCCCGGCCCCTCCTTCGCAGGGGGAGCGAGGCGACGGTTGCCGGGAAGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl