Prev. |  KEGG KO K10279 > 

RIKEN DNA Bank Human Resource - FBXL13

Gene ID NCBI Gene 222235 |  KEGG hsa:222235
Gene Symbol FBXL13
Protein Name F-box and leucine rich repeat protein 13
Synonyms DRC6|Fbl13
Ortholog resource in our bank

  FBXL13

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX010989 IRAK027H21 pCMV-SPORT6 BC020572 NM_145032 Partial
HGX011167 IRAK027P07 pCMV-SPORT6 BC020575 NM_145032 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR432623 RBdS081J07 pGCAP10 NM_145032.3  
GACCATTGTACTCCAGCTGGGCAACAAGAGCGAAACTTCGTCTCAAAAAAAAGTTCCAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl